EZ-QC™ XBG mRNA Capping Efficiency Assay Kit

Q: What is the difference between the EZ-QC™ mRNA Capping Efficiency Assay Kit and the EZ-QC™ XBG mRNA Capping Efficiency Assay Kit?

A: The EZ-QC™ XBG mRNA Capping Efficiency Assay Kit is designed specifically to be used on RNA containing a Xenopus β-globin (XBG) 5′ UTR. As such, the kit provides an XBG 5’ UTR-specific chimeric RNA-DNA-RNA Targeting Oligo and a Control Mix comprised of capped and uncapped RNAs containing XBG 5’ UTR sequences. In contrast, the EZ-QC™ mRNA Capping Efficiency Assay Kit is designed for use on any RNA of known sequence. As such, the kit does not include a targeting oligo. The user designs and supplies their own RNA-specific targeting oligo to be used in the capping efficiency assay.

Q: What is the XBG 5' UTR Control Mix, that is provided in the EZ-QC™ XBG mRNA Capping Efficiency Assay Kit, comprised of?

A: The XBG 5’ UTR Control Mix is a mixture of 80% capped (56 nt) and 20% uncapped (55 nt) RNAs containing XBG 5’ UTR sequences that can be used in conjunction with the kit provided XBG 5’ UTR Targeting Oligo.
XBG 5′ UTR Control Mix, where G = Cap 0 cap structure:

20%        GGGUAAUACAAGCUUGCUUGUUCUUUUUGCAGAAGCUCAGAAUAAACGCUCAACU-3′

80%      G•GGGUAAUACAAGCUUGCUUGUUCUUUUUGCAGAAGCUCAGAAUAAACGCUCAACU-3′

Q: What is the sequence of the XBG 5' UTR Targeting Oligo provided in the EZ-QC™ XBG mRNA Capping Efficiency Assay Kit?

A: Where BOLD = DNA bases:
5′-rCrUrGrArGrCdTdTdCdTrGrCrArArArArArG-3′

Q: What is the reason for making an EZ-QC™ mRNA Capping Efficiency Assay Kit specifically for use on XBG 5’ UTR containing RNAs?

A: The Xenopus β-globin 5′ UTR has a long history of use as an mRNA expression enhancer feature in mRNA production constructs. As such, a wealth of expression clones already exists in the scientific community, and it is still a popular choice for inclusion in new clones. Users of XBG 5’ UTR-containing expression clones would not need to design and supply their own chimeric RNA-DNA-RNA targeting oligo since it is supplied in the kit.

Q: Will the XBG 5' UTR Targeting Oligo provided in the EZ-QC™ XBG mRNA Capping Efficiency Assay Kit work on other 5’ UTR sequences, or globin gene 5’ UTR sequences?

A: No, it is specific for Xenopus β-globin 5′ UTR sequences (perfectly complementary to the XBG 5′ UTR Targeting Oligo) only.

Q: Will the EZ-QC™ mRNA Capping Efficiency Assay Kits work on mRNA containing nucleoside analogs (modified nucleosides) including pseudouridine and N1-methyl-pseudouridine?

A: Yes, both EZ-QC™ mRNA Capping Efficiency Assay Kits are applicable to uridine-, pseudouridine- and N1-methyl-pseudouridine-containing mRNAs.

Q: Can I use a different % acrylamide gel?

A: The best resolution was found with 20% acrylamide. Even with 17% the band separation is difficult to visualize.

Q: Can I use a pre-cast gel?

A: Yes, if the pre-cast is 20% acrylamide.

Q: Can the EZ-QC™ XBG mRNA Capping Efficiency Assay Kit detect the difference between Cap 0 and Cap 1?

A: No, the EZ-QC™ XBG mRNA Capping Efficiency Assay Kit can only determine if a sample is capped (Cap 0 or Cap 1) or uncapped. To quantitate the percent Cap 1 and percent Cap 0 content of your mRNA production product, CELLSCRIPT™ offers the EZ-QC™ mRNA Cap 1 Efficiency Assay Kit.

Sample Product(x1) added to cart

Cellscript Menu